Protein Synthesis

Decode this DNA strand!

TACGGGGGCGTAACCACAACT

Historical Influences on Darwin

1.  Jean Baptiste Lamarck

 

2. Jean Baptiste Lamarck He proposed an idea that living things did change and evolve. His idea (the inheritance of acquired characteristics) was wrong, but it helped convince the scientific communities believe that living things had not always been the way they are now.

 

·         http://necsi.edu/projects/evolution/lamarck/lamarck/lamarck_lamarck.html

 

3. Jean-Baptiste Lamarck had a lot of thoughts of evolution and how it would work. He also came up on a theory known inheritance this theory was about how if the organisms didn’t have body parts it can disappear within time. this includes his thoughts on natural science on environment.  At the beginning of this theory Darwin was against it. But then later he agreed with Lamarck in how it would work on evolution by making the organism stronger.

 

4. I don’t believe Darwin could have developed his own theory of Natural Science. Without the help of Jean Baptise Lamarck. Due to the fact that Lamarck had promoted evolutionary theories that helped Darwin find a lot of evidence.

 

 

 

5. On the Origin of Species The attitude of the church affected Darwin. And due to the differences of religion and science the church had claimed that God wouldn’t allow it the church was against the book when it was published and tried keeping it away from teaching it.

 

 

Historical Influences on Darwin

                                                                                                                 Aileen Montesflores

                                                                                                                 Blog #1

                                                                                                                  Anthropology 101

1.  Jean Baptiste Lamarck

 

2. Jean Baptiste Lamarck He proposed an idea that living things did change and evolve. His idea (the inheritance of acquired characteristics) was wrong, but it helped convince the scientific communities believe that living things had not always been the way they are now.

 

·         http://necsi.edu/projects/evolution/lamarck/lamarck/lamarck_lamarck.html

 

3. Jean-Baptiste Lamarck had a lot of thoughts of evolution and how it would work. He also came up on a theory known inheritance this theory was about how if the organisms didn’t have body parts it can disappear within time. this includes his thoughts on natural science on environment.  At the beginning of this theory Darwin was against it. But then later he agreed with Lamarck in how it would work on evolution by making the organism stronger.

 

4. I don’t believe Darwin could have developed his own theory of Natural Science. Without the help of Jean Baptise Lamarck. Due to the fact that Lamarck had promoted evolutionary theories that helped Darwin find a lot of evidence.

 

5. On the Origin of Species The attitude of the church affected Darwin. And due to the differences of religion and science the church had claimed that God wouldn’t allow it the church was against the book when it was published and tried keeping it away from teaching it.

 

test blog post

this is a test