Aileen, the assignment ask that you create a sentence and the one above makes no sense. A grammatically correct sentence was needed so your decoder knew when they were on the right track with the decode. Judy didn't have that benefit.
You do have a start codon, so no problems figuring out where to start, but you were missing a stop codon and random bases at either end. There was also a 8 word minimum for the sentence, so this was a bit short. You did take this to the DNA, but I can't be sure of your coding process since I can't tell from the sentence structure and grammar.
Here is my decode for reference:
DNA: TACGGGGGCGTAACCACAACT RNA triplets: AUG CCC CCG CAU UGG UGU UGA (start) Want study sleep the before it.
great job!
ReplyDeleteJudy, that is what I decoded as well.
ReplyDeleteAileen, the assignment ask that you create a sentence and the one above makes no sense. A grammatically correct sentence was needed so your decoder knew when they were on the right track with the decode. Judy didn't have that benefit.
You do have a start codon, so no problems figuring out where to start, but you were missing a stop codon and random bases at either end. There was also a 8 word minimum for the sentence, so this was a bit short. You did take this to the DNA, but I can't be sure of your coding process since I can't tell from the sentence structure and grammar.
Here is my decode for reference:
DNA: TACGGGGGCGTAACCACAACT
RNA triplets: AUG CCC CCG CAU UGG UGU UGA
(start) Want study sleep the before it.